pMH4-SYN-EGFP-ER
(Plasmid
#22285)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMH4
- Backbone size w/o insert (bp) 6959
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5a or JM 109 high efficiency
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEGFP-ER
-
Alt nameEGFP(A206K)mut-ER
-
Speciesmixture
-
Insert Size (bp)863
-
MutationEGFP alanine 206 changed to Lysin
-
Tag
/ Fusion Protein
- EGFP-ER
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gactcagcgctgcctcagtctg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
EGFP(A206K)= 925-1707
Calreticulin sgnalseq.=862-912
KDEL coding seq.=1714-1725
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH4-SYN-EGFP-ER was a gift from Thomas Oertner (Addgene plasmid # 22285 ; http://n2t.net/addgene:22285 ; RRID:Addgene_22285) -
For your References section:
Differential distribution of endoplasmic reticulum controls metabotropic signaling and plasticity at hippocampal synapses. Holbro N, Grunditz A, Oertner TG. Proc Natl Acad Sci U S A. 2009 Sep 1;106(35):15055-60. doi: 10.1073/pnas.0905110106. Epub 2009 Aug 18. 10.1073/pnas.0905110106 PubMed 19706463