Skip to main content

pSems LifeAct-StayGold
(Plasmid #222947)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222947 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSEMS(26m)
  • Backbone manufacturer
    EMD Biosciences
  • Total vector size (bp) 5972
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LifeAct
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    782
  • Promoter CMV
  • Tag / Fusion Protein
    • StayGold (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAACAGCTGGCCCTCGCAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

StayGold from Addgene #185823

Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, Deguchi R, Endo K, Haga K, Takai-Todaka R, Inaura S, Matsumura Y, Hama H, Okada Y, Fujiwara T, Morimoto T, Katayama K, Miyawaki A. A highly photostable and bright green fluorescent protein. Nat Biotechnol. 2022 Jul;40(7):1132-1142. doi: 10.1038/s41587-022-01278-2. Epub 2022 Apr 25. Erratum in: Nat Biotechnol. 2022 Sep;40(9):1412. doi: 10.1038/s41587-022-01469-x. PMID: 35468954; PMCID: PMC9287174.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSems LifeAct-StayGold was a gift from Jacob Piehler (Addgene plasmid # 222947 ; http://n2t.net/addgene:222947 ; RRID:Addgene_222947)
  • For your References section:

    Correlative single-molecule and structured illumination microscopy of fast dynamics at the plasma membrane. Winkelmann H, Richter CP, Eising J, Piehler J, Kurre R. Nat Commun. 2024 Jul 10;15(1):5813. doi: 10.1038/s41467-024-49876-9. 10.1038/s41467-024-49876-9 PubMed 38987559