T7_CC_PE7_IVT_Template
(Plasmid
#223022)
-
PurposeTemplate for in vitro transcription of PE7. For HSPC-related experiments.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBR322
- Total vector size (bp) 10862
-
Vector typeTemplate for in vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE7
-
Alt namePEmax-La(SSB)1-194
-
SpeciesH. sapiens (human), Synthetic; SpCas9 is from Streptococcus pyogenes; MMLV_RT is from the Moloney murine leukemia virus; La(SSB)1-194 is from Homo sapiens
-
Insert Size (bp)7071
- Promoter T7
-
Tags
/ Fusion Proteins
- SV40 bpNLS (N terminal on insert)
- SV40 bpNLS (C terminal on insert)
- c-Myc NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7_CC_PE7_IVT_Template was a gift from Brittany Adamson (Addgene plasmid # 223022 ; http://n2t.net/addgene:223022 ; RRID:Addgene_223022) -
For your References section:
Improving prime editing with an endogenous small RNA-binding protein. Yan J, Oyler-Castrillo P, Ravisankar P, Ward CC, Levesque S, Jing Y, Simpson D, Zhao A, Li H, Yan W, Goudy L, Schmidt R, Solley SC, Gilbert LA, Chan MM, Bauer DE, Marson A, Parsons LR, Adamson B. Nature. 2024 Apr 3. doi: 10.1038/s41586-024-07259-6. 10.1038/s41586-024-07259-6 PubMed 38570691