Skip to main content
Addgene

rag2:AGAP2_CE_pISceI
(Plasmid #223024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223024 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Rag2 plasmid
  • Backbone size w/o insert (bp) 12500
  • Vector type
    Express the insert(gene) in mesenchymal lineage of Zebrafish.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AGAP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3579
  • Entrez Gene
    AGAP2 (a.k.a. CENTG1, GGAP2, PIKE)
  • Promoter Rag2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bcli (unknown if destroyed)
  • 3′ cloning site Clai (unknown if destroyed)
  • 5′ sequencing primer CTGTGGTAAAGCCATGGTTG
  • 3′ sequencing primer GCCCTAGTGAGAGCCGTACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rag2:AGAP2_CE_pISceI was a gift from Alejandro Gutierrez (Addgene plasmid # 223024 ; http://n2t.net/addgene:223024 ; RRID:Addgene_223024)
  • For your References section:

    A methyltransferase-independent role for METTL1 in tRNA aminoacylation and oncogenic transformation. Ali RH, Orellana EA, Lee SH, Chae YC, Chen Y, Clauwaert J, Kennedy AL, Gutierrez AE, Papke DJ, Valenzuela M, Silverman B, Falzetta A, Ficarro SB, Marto JA, Fletcher CDM, Perez-Atayde A, Alcindor T, Shimamura A, Prensner JR, Gregory RI, Gutierrez A. Mol Cell. 2025 Mar 6;85(5):948-961.e11. doi: 10.1016/j.molcel.2025.01.003. Epub 2025 Jan 31. 10.1016/j.molcel.2025.01.003 PubMed 39892392