pTRE2_CMV_Mex3a_t2a_mCherry
(Plasmid
#223244)
-
PurposetetO responsive expression of Mex3a in mammalian cells with t2a cleaved mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTRE2
- Total vector size (bp) 6093
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMex3a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1560
-
Mutationamino acids conserved, underlying DNA sequence reduced in CGs
-
Entrez GeneMex3a (a.k.a. 2700083E18Rik, Gm411, Rkhd4)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TGGAGACGCCATCCACGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note, this Mex3a construct conserves mus musculus Mex3a amino acids, but underlying DNA sequence has been modified to reduce CG content.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE2_CMV_Mex3a_t2a_mCherry was a gift from Stavros Lomvardas (Addgene plasmid # 223244 ; http://n2t.net/addgene:223244 ; RRID:Addgene_223244)