REKAR67
(Plasmid
#223261)
-
PurposeEKAREN4 modified to be a Red-FRET sensor using miRFP670nano3 and miRFP720 (in that order; AKA REKAR67)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameREKAR-67
-
Alt nameRed-EKAREN4-67
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2010
-
MutationmiRFP670nano3 - EKAREN4 - miRFP720
- Promoter hEF-1a
-
Tags
/ Fusion Proteins
- miRFP670nano3 (N terminal on insert)
- miRFP720 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ATGGCAAACCTGGACAAGATGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
miRFP670nano3 is from: Oliinyk, O. S. et al. Single-domain near-infrared protein provides a scaffold for antigen-dependent fluorescent nanobodies. Nat. Methods 19, 740–750 (2022).
miRFP720 is from: Matlashov, M. E. et al. A set of monomeric near-infrared fluorescent proteins for multicolor imaging across scales. Nat. Commun. 11, 239 (2020).
EKAREN4 is from: Ponsioen, B. et al. Quantifying single-cell ERK dynamics in colorectal cancer organoids reveals EGFR as an amplifier of oncogenic MAPK pathway signalling. Nat. Cell Biol. 23, 377–390 (2021).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
REKAR67 was a gift from John Albeck (Addgene plasmid # 223261 ; http://n2t.net/addgene:223261 ; RRID:Addgene_223261) -
For your References section:
Two novel red-FRET ERK biosensors in the 670-720 nm range. DeCuzzi NL, Hu JY, Xu F, Rodriguez B, Pargett M, Albeck JG. J Biol Eng. 2025 Nov 13;19(1):102. doi: 10.1186/s13036-025-00541-9. 10.1186/s13036-025-00541-9 PubMed 41233897