Skip to main content

REKAR67
(Plasmid #223261)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223261 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    REKAR-67
  • Alt name
    Red-EKAREN4-67
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2010
  • Mutation
    miRFP670nano3 - EKAREN4 - miRFP720
  • Promoter hEF-1a
  • Tags / Fusion Proteins
    • miRFP670nano3 (N terminal on insert)
    • miRFP720 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ATGGCAAACCTGGACAAGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

miRFP670nano3 is from: Oliinyk, O. S. et al. Single-domain near-infrared protein provides a scaffold for antigen-dependent fluorescent nanobodies. Nat. Methods 19, 740–750 (2022).

miRFP720 is from: Matlashov, M. E. et al. A set of monomeric near-infrared fluorescent proteins for multicolor imaging across scales. Nat. Commun. 11, 239 (2020).

EKAREN4 is from: Ponsioen, B. et al. Quantifying single-cell ERK dynamics in colorectal cancer organoids reveals EGFR as an amplifier of oncogenic MAPK pathway signalling. Nat. Cell Biol. 23, 377–390 (2021).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    REKAR67 was a gift from John Albeck (Addgene plasmid # 223261 ; http://n2t.net/addgene:223261 ; RRID:Addgene_223261)
  • For your References section:

    Two novel red-FRET ERK biosensors in the 670-720 nm range. DeCuzzi NL, Hu JY, Xu F, Rodriguez B, Pargett M, Albeck JG. J Biol Eng. 2025 Nov 13;19(1):102. doi: 10.1186/s13036-025-00541-9. 10.1186/s13036-025-00541-9 PubMed 41233897