pC0043-PspCas13b-gRNA LINE1
(Plasmid
#223699)
-
PurposegRNA of dPspCas13b-FTO targeting LINE1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepC0043
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA target sequence for LINE1
-
gRNA/shRNA sequenceCAGATACCAGGTACCAAAGTT
-
SpeciesM. musculus (mouse)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0043-PspCas13b-gRNA LINE1 was a gift from Chuan He (Addgene plasmid # 223699 ; http://n2t.net/addgene:223699 ; RRID:Addgene_223699) -
For your References section:
FTO mediates LINE1 m(6)A demethylation and chromatin regulation in mESCs and mouse development. Wei J, Yu X, Yang L, Liu X, Gao B, Huang B, Dou X, Liu J, Zou Z, Cui XL, Zhang LS, Zhao X, Liu Q, He PC, Sepich-Poore C, Zhong N, Liu W, Li Y, Kou X, Zhao Y, Wu Y, Cheng X, Chen C, An Y, Dong X, Wang H, Shu Q, Hao Z, Duan T, He YY, Li X, Gao S, Gao Y, He C. Science. 2022 May 27;376(6596):968-973. doi: 10.1126/science.abe9582. Epub 2022 May 5. 10.1126/science.abe9582 PubMed 35511947