pHR-SFFV-FLAG-TurboID
(Plasmid
#223713)
-
PurposeExpresses Flag-tagged TurboID
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223713 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepHR-SFFV
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTurboID
-
Alt nameTurboID
-
SpeciesSynthetic
-
GenBank ID
- Promoter SFFV
Cloning Information
- Cloning method Other
- 5′ sequencing primer acgcgtGCTAGCTaccggtagccaccatggacta
- 3′ sequencing primer tgcggccgcaagtcaaggatcttaatcagttatctagatccggtggatccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAlice Ting Laboratory
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.12.12.571324 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SFFV-FLAG-TurboID was a gift from Benjamin Wolozin (Addgene plasmid # 223713 ; http://n2t.net/addgene:223713 ; RRID:Addgene_223713) -
For your References section:
Proximity labeling reveals dynamic changes in the SQSTM1 protein network. Ortiz ANR, Zhang L, Ash PEA, Basu A, Puri S, van der Spek SJF, Wang Z, Dorrian L, Emili A, Wolozin B. bioRxiv [Preprint]. 2024 Jun 27:2023.12.12.571324. doi: 10.1101/2023.12.12.571324. 10.1101/2023.12.12.571324 PubMed 38168279