pJExpress401-KDAC8
(Plasmid
#224208)
-
PurposeExpresses human KDAC8 (HDAC8) in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepJExpress401
-
Backbone manufacturerDNA 2.0
- Backbone size w/o insert (bp) 3936
- Total vector size (bp) 5109
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDAC8
-
Alt nameHDAC8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1173
-
Entrez GeneHDAC8 (a.k.a. CDA07, CDLS5, HD8, HDACL1, KDAC8, MRXS6, RPD3, WTS)
- Promoter T5
-
Tag
/ Fusion Protein
- TEV-cleavable His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
- 3′ sequencing primer TGGTAGTGTGGGGACTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Codon optimized for bacterial expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJExpress401-KDAC8 was a gift from Terry Watt (Addgene plasmid # 224208 ; http://n2t.net/addgene:224208 ; RRID:Addgene_224208) -
For your References section:
KDAC8 substrate specificity quantified by a biologically relevant, label-free deacetylation assay. Toro TB, Watt TJ. Protein Sci. 2015 Dec;24(12):2020-32. doi: 10.1002/pro.2813. Epub 2015 Oct 7. 10.1002/pro.2813 PubMed 26402585