pFastBacHTa_HCK
(Plasmid
#224245)
-
PurposeExpression of human HCK Kinase in insect cells (SF9 cells)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFastBacHT A
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 4837
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehck
-
Alt nameAIPCV, JTK9, p59Hck, p61Hck
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1425
-
Entrez GeneHCK (a.k.a. AIPCV, JTK9, p59Hck, p61Hck)
- Promoter polyhedrin promoter
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ACCATCTCGCAAATAAATAAG
- 3′ sequencing primer TAAGCTGCAATAAACAAGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBacHTa_HCK was a gift from Andrew Mesecar (Addgene plasmid # 224245 ; http://n2t.net/addgene:224245 ; RRID:Addgene_224245)