pJExpress401-KDAC4 CD
(Plasmid
#224251)
-
PurposeExpresses human KDAC4 (HDAC4) catalytic domain in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepJExpress401
-
Backbone manufacturerDNA 2.0
- Backbone size w/o insert (bp) 3936
- Total vector size (bp) 5292
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDAC4
-
Alt nameHDAC4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1356
-
MutationOnly includes residues 648-1083 (catalytic domain).
-
Entrez GeneHDAC4 (a.k.a. AHO3, BDMR, HA6116, HD4, HDAC-4, HDAC-A, HDACA, NEDCHF, NEDCHID)
- Promoter T5
-
Tag
/ Fusion Protein
- TEV-cleavable His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
- 3′ sequencing primer TGGTAGTGTGGGGACTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Codon optimized for bacterial expression. Catalytic domain only.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJExpress401-KDAC4 CD was a gift from Terry Watt (Addgene plasmid # 224251 ; http://n2t.net/addgene:224251 ; RRID:Addgene_224251) -
For your References section:
Purification of metal-dependent lysine deacetylases with consistently high activity. Toro TB, Painter RG, Haynes RA, Glotser EY, Bratton MR, Bryant JR, Nichols KA, Matthew-Onabanjo AN, Matthew AN, Bratcher DR, Perry CD, Watt TJ. Protein Expr Purif. 2018 Jan;141:1-6. doi: 10.1016/j.pep.2017.08.009. Epub 2017 Aug 24. 10.1016/j.pep.2017.08.009 PubMed 28843507