pJExpress401-T4 Lysozyme C54T C97A (WT*)
(Plasmid
#224353)
-
PurposeExpresses T4 lysozyme in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepJExpress401
-
Backbone manufacturerDNA 2.0
- Backbone size w/o insert (bp) 3936
- Total vector size (bp) 4461
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT4 Lysozyme
-
SpeciesBacteriophage T4
-
Insert Size (bp)525
-
MutationC45T, C94A
-
GenBank IDNP_049736
- Promoter T5
-
Tag
/ Fusion Protein
- TEV-cleavable His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
- 3′ sequencing primer TGGTAGTGTGGGGACTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBrian Matthews: Addgene 18111 (pHS1403 T4 Lysozyme WT*)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJExpress401-T4 Lysozyme C54T C97A (WT*) was a gift from Terry Watt (Addgene plasmid # 224353 ; http://n2t.net/addgene:224353 ; RRID:Addgene_224353) -
For your References section:
An improved 96-well turbidity assay for T4 lysozyme activity. Toro TB, Nguyen TP, Watt TJ. MethodsX. 2015 May 18;2:256-62. doi: 10.1016/j.mex.2015.05.004. eCollection 2015. 10.1016/j.mex.2015.05.004 PubMed 26150996