pEN243-EN1953
(Plasmid
#224546)
-
PurposeCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459
-
Backbone manufacturerAddgene #62988
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl
-
gRNA/shRNA sequenceCCAGAACTTCAGGATGAATG
-
SpeciesM. musculus (mouse)
-
Entrez GeneNipbl (a.k.a. Idn3)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN243-EN1953 was a gift from Elphege Nora (Addgene plasmid # 224546 ; http://n2t.net/addgene:224546 ; RRID:Addgene_224546) -
For your References section:
Synergy between regulatory elements can render cohesin dispensable for distal enhancer function. Hansen KL, Adachi AS, Braccioli L, Kadvani S, Boileau RM, Martinovic M, Pokorny B, Shah R, Anderson EC, Zhang K, Carel I, Bonitto K, Blelloch R, Fudenberg G, de Wit E, Nora EP. Science. 2025 Nov 27:eadt4221. doi: 10.1126/science.adt4221. 10.1126/science.adt4221 PubMed 41308125