Skip to main content

VPS13B^GFP
(Plasmid #224588)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224588 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VPS13B^GFP
  • Species
    H. sapiens (human)
  • Entrez Gene
    VPS13B (a.k.a. BLTP5B, CHS1, COH1)
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BAMHI (not destroyed)
  • 3′ cloning site BAMHI (not destroyed)
  • 5′ sequencing primer GGCGATGCGTTCCCTTGGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This was synthesized by Genscript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.12.18.572081 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VPS13B^GFP was a gift from Pietro De Camilli (Addgene plasmid # 224588 ; http://n2t.net/addgene:224588 ; RRID:Addgene_224588)
  • For your References section:

    VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1. Ugur B, Schueder F, Shin J, Hanna MG, Wu Y, Leonzino M, Su M, McAdow AR, Wilson C, Postlethwait J, Solnica-Krezel L, Bewersdorf J, De Camilli P. bioRxiv [Preprint]. 2023 Dec 18:2023.12.18.572081. doi: 10.1101/2023.12.18.572081. 10.1101/2023.12.18.572081 PubMed 38187698