pGEMHE:mTREK-1(tandem wt-wt)
(Plasmid
#224757)
-
PurposeIn vitro transcription for Oocyte expression of mTREK-1(tandem wt-wt)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEMHE
-
Vector typeIn vitro transcription for Oocyte expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTandem TREK-1 (wt-wt)
-
Alt nameKcnk2
-
Alt nameTREK-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1236
-
Entrez GeneKcnk2 (a.k.a. A430027H14Rik, TREK-1)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE:mTREK-1(tandem wt-wt) was a gift from Dan Minor (Addgene plasmid # 224757 ; http://n2t.net/addgene:224757 ; RRID:Addgene_224757) -
For your References section:
Metabolic and thermal stimuli control K(2P)2.1 (TREK-1) through modular sensory and gating domains. Bagriantsev SN, Clark KA, Minor DL Jr. EMBO J. 2012 Aug 1;31(15):3297-308. doi: 10.1038/emboj.2012.171. Epub 2012 Jun 22. 10.1038/emboj.2012.171 PubMed 22728824