pUC-hU6-2O-crBFP_EF1a-BFP
(Plasmid
#224783)
-
PurposeBFP-targeting crRNA for RfxCas13d expressed from hU6-2xTetO promoter and target BFP protein expressed from EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC-hU6-2O-crScaffold_EF1a-BFP
-
Backbone manufacturerBalazsi Lab
- Backbone size w/o insert (bp) 4361
- Total vector size (bp) 4384
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrBFP
-
gRNA/shRNA sequenceTTGAAGTAAAGTTTACGCCTCGA
-
SpeciesSynthetic
- Promoter hU6-2xTetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.11.593702 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC-hU6-2O-crBFP_EF1a-BFP was a gift from Gabor Balazsi (Addgene plasmid # 224783 ; http://n2t.net/addgene:224783 ; RRID:Addgene_224783) -
For your References section:
Optimizing a CRISPR-Cas13d Gene Circuit for Tunable Target RNA Downregulation with Minimal Collateral RNA Cutting. Wan Y, Helenek C, Coraci D, Balazsi G. ACS Synth Biol. 2024 Oct 18;13(10):3212-3230. doi: 10.1021/acssynbio.4c00271. Epub 2024 Oct 8. 10.1021/acssynbio.4c00271 PubMed 39377757