Skip to main content

pUC-hU6-crCoV-Mutiplex_EF1a-BFP
(Plasmid #224788)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224788 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLQ5429
  • Backbone manufacturer
    Balazsi Lab
  • Backbone size w/o insert (bp) 4341
  • Total vector size (bp) 4479
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crCoV20, crCoV21, crCoV24
  • gRNA/shRNA sequence
    cactattagcataagcagttgt, ttgaatctgagggtccaccaaa, aacgccttgtcctcgagggaat
  • Promoter hU6

Cloning Information

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.05.11.593702 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC-hU6-crCoV-Mutiplex_EF1a-BFP was a gift from Gabor Balazsi (Addgene plasmid # 224788 ; http://n2t.net/addgene:224788 ; RRID:Addgene_224788)
  • For your References section:

    Optimizing a CRISPR-Cas13d Gene Circuit for Tunable Target RNA Downregulation with Minimal Collateral RNA Cutting. Wan Y, Helenek C, Coraci D, Balazsi G. ACS Synth Biol. 2024 Oct 18;13(10):3212-3230. doi: 10.1021/acssynbio.4c00271. Epub 2024 Oct 8. 10.1021/acssynbio.4c00271 PubMed 39377757