Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SFG.wtCNb_opt.IRES.eGFP
(Plasmid #22492)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22492 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    SFG
  • Backbone size w/o insert (bp) 7678
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Codon optimised wild type Calcineurin B
  • Alt name
    wtCNb
  • Alt name
    CNb
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    513
  • GenBank ID
    GQ463596
  • Entrez Gene
    PPP3R1 (a.k.a. CALNB1, CNB, CNB1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer ttacacagtcctgctgaccacc
  • 3′ sequencing primer caagcggcttcggccagtaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SFG.wtCNb_opt.IRES.eGFP was a gift from Martin Pule (Addgene plasmid # 22492 ; http://n2t.net/addgene:22492 ; RRID:Addgene_22492)
  • For your References section:

    Generation of EBV-specific cytotoxic T-cells that are resistant to calcineurin inhibitors for the treatment of post-transplant lymphoproliferative disease. Brewin J, Mancao C, Straathof K, Karlsson H, Samarasinghe S, Amrolia PJ, Pule M. Blood. 2009 Sep 21. ():. 10.1182/blood-2009-07-228387 PubMed 19770360