Skip to main content

pET11a-AldoA
(Plasmid #224925)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224925 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET11a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5641
  • Total vector size (bp) 6733
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Aldolase A
  • Alt name
    Fructose-bisphosphate aldolase A
  • Alt name
    AldoA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1092
  • Entrez Gene
    ALDOA (a.k.a. ALDA, GSD12, HEL-S-87p)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET11a-AldoA was a gift from Liskin Swint-Kruse (Addgene plasmid # 224925 ; http://n2t.net/addgene:224925 ; RRID:Addgene_224925)
  • For your References section:

    Substitutions at a rheostat position in human aldolase A cause a shift in the conformational population. Fenton KD, Meneely KM, Wu T, Martin TA, Swint-Kruse L, Fenton AW, Lamb AL. Protein Sci. 2022 Feb;31(2):357-370. doi: 10.1002/pro.4222. Epub 2021 Nov 12. 10.1002/pro.4222 PubMed 34734672