Skip to main content

pET22b Ag43 160N 6H sfGFP-R5 AmpR
(Plasmid #225139)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225139 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pet22B
  • Backbone size w/o insert (bp) 5370
  • Total vector size (bp) 8829
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ag43 protein fused to silaffin-R5 and sfGFP
  • Species
    Cylindrotheca fusiformis, Escherichia coli, Aequorea victoria
  • Insert Size (bp)
    3429
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b Ag43 160N 6H sfGFP-R5 AmpR was a gift from Urartu Seker (Addgene plasmid # 225139 ; http://n2t.net/addgene:225139 ; RRID:Addgene_225139)
  • For your References section:

    A living material platform for the biomineralization of biosilica. Kirpat Konak BM, Bakar ME, Ahan RE, Ozyurek EU, Dokmeci S, Safak Seker UO. Mater Today Bio. 2022 Oct 10;17:100461. doi: 10.1016/j.mtbio.2022.100461. eCollection 2022 Dec 15. 10.1016/j.mtbio.2022.100461 PubMed 36278145