pET22b Ag43 160N 6H sfGFP-R5 AmpR
(Plasmid
#225139)
-
PurposeRecombinant Ag43 protein fused to silaffin-R5 and sfGFP. pelB as the periplasmic signal. His-tag for purification. TEV enzyme recognition site between Ag43 alpha subunit and the fluorescent protein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet22B
- Backbone size w/o insert (bp) 5370
- Total vector size (bp) 8829
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAg43 protein fused to silaffin-R5 and sfGFP
-
SpeciesCylindrotheca fusiformis, Escherichia coli, Aequorea victoria
-
Insert Size (bp)3429
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
- 3′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b Ag43 160N 6H sfGFP-R5 AmpR was a gift from Urartu Seker (Addgene plasmid # 225139 ; http://n2t.net/addgene:225139 ; RRID:Addgene_225139) -
For your References section:
A living material platform for the biomineralization of biosilica. Kirpat Konak BM, Bakar ME, Ahan RE, Ozyurek EU, Dokmeci S, Safak Seker UO. Mater Today Bio. 2022 Oct 10;17:100461. doi: 10.1016/j.mtbio.2022.100461. eCollection 2022 Dec 15. 10.1016/j.mtbio.2022.100461 PubMed 36278145