pET22b-T7-6h-GST-α-Synuclein
(Plasmid
#225224)
-
PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET22b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5366
- Total vector size (bp) 6506
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGST
-
SpeciesE. coli
-
Insert Size (bp)654
-
GenBank ID914142
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis Tag (N terminal on insert)
- TEV Cleavage Site (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameα-Synuclein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)420
-
GenBank ID6622
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-T7-6h-GST-α-Synuclein was a gift from Urartu Seker (Addgene plasmid # 225224 ; http://n2t.net/addgene:225224 ; RRID:Addgene_225224) -
For your References section:
Synergistic Screening of Peptide-Based Biotechnological Drug Candidates for Neurodegenerative Diseases Using Yeast Display and Phage Display. Ozcelik CE, Begli O, Hincer A, Ahan RE, Kesici MS, Oguz O, Kasirga TS, Ozcubukcu S, Seker UOS. ACS Chem Neurosci. 2023 Oct 4;14(19):3609-3621. doi: 10.1021/acschemneuro.3c00248. Epub 2023 Aug 28. 10.1021/acschemneuro.3c00248 PubMed 37638647