Skip to main content

pGP-Tn7-PcL
(Plasmid #225281)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225281 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGP-Tn7-Cm
  • Backbone size (bp) 6238
  • Vector type
    Bacterial Expression
  • Promoter Constitutive PcL promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Unknown

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGGAATCAGGGGATCTTG
  • 3′ sequencing primer TGACAAAATAGATGGGAACTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-Tn7-PcL was a gift from Mark Schembri (Addgene plasmid # 225281 ; http://n2t.net/addgene:225281 ; RRID:Addgene_225281)
  • For your References section:

    Modified Tn7 transposon vectors for controlled chromosomal gene expression. Chang C, Phan M-D, Schembri MA. Appl Environ Microbiol. 2024 Oct 23;90(10):e0155624. doi: 10.1128/aem.01556-24. Epub 2024 Sep 18. 10.1128/aem.01556-24 PubMed 39291982