pcDNA3puro-mGFP-FXR1a-sh5Resistant
              
              
                (Plasmid
                
                #225448)
              
            
            
            
          - 
            PurposeExpress mEGFP-fusion protein of FXR1 isoform a with shRNA5-resistant silent mutation
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepcDNA3-puro
- 
              Backbone manufacturerMayr Lab
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameFXR1 isoform a
- 
                    SpeciesH. sapiens (human)
- 
                        Entrez GeneFXR1 (a.k.a. CMYP9A, CMYP9B, FXR1P, MYOPMIL, MYORIBF)
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - mEGFP (N terminal on insert)
 
Cloning Information
- Cloning method Other
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pcDNA3puro-mGFP-FXR1a-sh5Resistant was a gift from Christine Mayr (Addgene plasmid # 225448 ; http://n2t.net/addgene:225448 ; RRID:Addgene_225448)
- 
                For your References section: The FXR1 network acts as signaling scaffold for actomyosin remodeling. Chen X, Fansler MM, Janjoš U, Ule J, Mayr C. Cell. 5 August 2024. doi: 10.1016/j.cell.2024.07.015. 10.1016/j.cell.2024.07.015 PubMed 37961296
