Skip to main content

pcDNA3puro-mGFP-FMR1 isoform1-sh1Resistant
(Plasmid #225462)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225462 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3-puro
  • Backbone manufacturer
    Mayr Lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FMR1 isoform 1
  • Species
    H. sapiens (human)
  • Entrez Gene
    FMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mEGFP (N terminal on insert)

Cloning Information

  • Cloning method Other

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Resistant to shRNA TRCN0000059759 (target sequence GCGTTTGGAGAGATTACAAAT). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3puro-mGFP-FMR1 isoform1-sh1Resistant was a gift from Christine Mayr (Addgene plasmid # 225462 ; http://n2t.net/addgene:225462 ; RRID:Addgene_225462)
  • For your References section:

    The FXR1 network acts as signaling scaffold for actomyosin remodeling. Chen X, Fansler MM, Janjoš U, Ule J, Mayr C. Cell. 5 August 2024. doi: 10.1016/j.cell.2024.07.015. 10.1016/j.cell.2024.07.015 PubMed 37961296