-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 22551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-N-Flag-HA-IRES-PURO
-
Backbone manufacturerHarper_Lab
- Backbone size w/o insert (bp) 6521
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOTUB1
-
Alt nameOTU domain, ubiquitin aldehyde binding 1
-
Alt nameFLJ20113, FLJ40710, HSPC263, MGC111158, MGC4584, OTB1, OTU1
-
SpeciesH. sapiens (human)
-
MutationNone
-
GenBank IDBC007519.2
-
Entrez GeneOTUB1 (a.k.a. HSPC263, OTB1, OTU1)
-
Tags
/ Fusion Proteins
- HA (N terminal on backbone)
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site GATEWAY_LR (unknown if destroyed)
- 3′ cloning site GATEWAY_LR (unknown if destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAGG
- 3′ sequencing primer CAAGCGGCTTCGGCCAGTAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMarc_Vidal_Orfeome_collection
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-HA-OTUB1 was a gift from Wade Harper (Addgene plasmid # 22551 ; http://n2t.net/addgene:22551 ; RRID:Addgene_22551) -
For your References section:
Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732