Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #22558)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 22558 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6521
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)
  • Alt name
    MOV34, P40, S12
  • Species
    H. sapiens (human)
  • Mutation
  • GenBank ID
  • Entrez Gene
    PSMD7 (a.k.a. MOV34, P40, Rpn8, S12)
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site GATEWAY_LR (unknown if destroyed)
  • 3′ cloning site GATEWAY_LR (unknown if destroyed)
  • 5′ sequencing primer CAGCCCTCACTCCTTCTCTAGG
  • 3′ sequencing primer CAAGCGGCTTCGGCCAGTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-HA-PSMD7 was a gift from Wade Harper (Addgene plasmid # 22558 ; ; RRID:Addgene_22558)
  • For your References section:

    Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732