EKAREN5-gl
(Plasmid
#225958)
-
PurposeThe YPet and mTurquoise sequence cassettes in EKAREN5(Addgene 167821) were replaced with a synonymous codon variant of YPet and mTurquoise-gl and subcloned into pCSII lentiviral backbone.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCSII lentiviral vector
- Total vector size (bp) 12385
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEKAREN5-gl
-
SpeciesAequorea victoria
-
Insert Size (bp)3258
- Promoter EF-1-alpha promoter
-
Tag
/ Fusion Protein
- nls localization motif (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATTTGCCCTTTTTGAGTTTGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEKAREN5(Hugo Snippert lab)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EKAREN5-gl was a gift from Toru Hiratsuka (Addgene plasmid # 225958 ; http://n2t.net/addgene:225958 ; RRID:Addgene_225958) -
For your References section:
A sensitive ERK fluorescent probe reveals the significance of minimal EGF-induced transcription. Weisheng Z, Nakayama J, Inomata Y, Higashiyama S, Hiratsuka T. Cell Struct Funct. 2024 Dec 18. doi: 10.1247/csf.24070. 10.1247/csf.24070 PubMed 39694501