Skip to main content
Addgene

pGL3-Ctr1-gRNA-EGFP
(Plasmid #226000)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226000 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-U6-sgRNA-EGFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    negtive control sgRNA of no specific targets in human genome
  • gRNA/shRNA sequence
    gcgccaaacgtgccctgacgg
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The negtive nontargeting sgRNA sequence is accord to Gilbert et al. Cell. 2014, PMID: 25307932

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Ctr1-gRNA-EGFP was a gift from Miguel Ramalho-Santos (Addgene plasmid # 226000 ; http://n2t.net/addgene:226000 ; RRID:Addgene_226000)
  • For your References section:

    LINE1 and PRC2 control nucleolar organization and repression of the 8C state in human ESCs. Zhang J, Ataei L, Mittal K, Wu L, Caldwell L, Huynh L, Sarajideen S, Tse K, Simon MM, Mazid MA, Cook DP, Trcka D, Kwan T, Hoffman MM, Wrana JL, Esteban MA, Ramalho-Santos M. Dev Cell. 2024 Oct 14:S1534-5807(24)00574-4. doi: 10.1016/j.devcel.2024.09.024. 10.1016/j.devcel.2024.09.024 PubMed 39413784