Skip to main content

HMA-APOBEC1-Nb
(Plasmid #226012)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226012 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Total vector size (bp) 7058
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    APOBEC1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    684
  • Entrez Gene
    Apobec1 (a.k.a. REPR, apobec-1)
  • Tags / Fusion Proteins
    • His-MBP (N terminal on insert)
    • antiRabbit-nanobody (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HMA-APOBEC1-Nb was a gift from Eugene Yeo (Addgene plasmid # 226012 ; http://n2t.net/addgene:226012 ; RRID:Addgene_226012)
  • For your References section:

    High-sensitivity in situ capture of endogenous RNA-protein interactions in fixed cells and primary tissues. Liang Q, Yu T, Kofman E, Jagannatha P, Rhine K, Yee BA, Corbett KD, Yeo GW. Nat Commun. 2024 Aug 16;15(1):7067. doi: 10.1038/s41467-024-50363-4. 10.1038/s41467-024-50363-4 PubMed 39152130