HMA-APOBEC1-Nb
              
              
                (Plasmid
                
                #226012)
              
            
            
            
          - 
            PurposeFor expression of His-MBP-APOBEC1-Nanobody protein in E.coli
 - 
              Depositing Lab
 - 
          Sequence Information
- 
                  Sequences (1) — Accept Affinity Reagent Sequence Policy
 
 - 
                  
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepET
 - Total vector size (bp) 7058
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert nameAPOBEC1
 - 
                    SpeciesR. norvegicus (rat)
 - 
                  Insert Size (bp)684
 - 
                        Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
 - 
    
        Tags
        / Fusion Proteins
    
- His-MBP (N terminal on insert)
 - antiRabbit-nanobody (C terminal on insert)
 
 
Cloning Information
- Cloning method Ligation Independent Cloning
 - 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
 - 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
 
Resource Information
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
HMA-APOBEC1-Nb was a gift from Eugene Yeo (Addgene plasmid # 226012 ; http://n2t.net/addgene:226012 ; RRID:Addgene_226012) - 
                
For your References section:
High-sensitivity in situ capture of endogenous RNA-protein interactions in fixed cells and primary tissues. Liang Q, Yu T, Kofman E, Jagannatha P, Rhine K, Yee BA, Corbett KD, Yeo GW. Nat Commun. 2024 Aug 16;15(1):7067. doi: 10.1038/s41467-024-50363-4. 10.1038/s41467-024-50363-4 PubMed 39152130