MCP/PCP yellow RNA Lantern
(Plasmid
#226096)
-
PurposeRNA tracking
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3.1
- Backbone size w/o insert (bp) 5405
- Total vector size (bp) 8092
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-HA-MS2-SmBiT-IRES-PP7-Venus d12-LgBiT-FLAG
-
Insert Size (bp)2687
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGGAGACCCAAGCTTatgggcccaaaaaagaaaagaaaagtt
- 3′ sequencing primer CGGCCGCCAGTGTGATGGATATCTGCAGAATTCTTACTTGTCATCGTCGTCCTTGTAGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.07.02.498144 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCP/PCP yellow RNA Lantern was a gift from Jennifer Prescher (Addgene plasmid # 226096 ; http://n2t.net/addgene:226096 ; RRID:Addgene_226096) -
For your References section:
A modular platform for bioluminescent RNA tracking. Halbers LP, Cole KH, Ng KK, Fuller EB, Chan CET, Callicoatte C, Metcalfe M, Chen CC, Barhoosh AA, Reid-McLaughlin E, Kent AD, Torrey ZR, Steward O, Luptak A, Prescher JA. Nat Commun. 2024 Nov 18;15(1):9992. doi: 10.1038/s41467-024-54263-5. 10.1038/s41467-024-54263-5 PubMed 39557883