GCaMP-AMPK-SPARK
(Plasmid
#226257)
-
PurposeDual reporter of Ca2+ levels and AMPK activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepTwist CMV
- Backbone size w/o insert (bp) 4181
- Total vector size (bp) 6569
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP-AMPK-SPARK
-
Alt nameGCaMP6f-AMPK-SPARK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2388
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GAGCTGGTTTAGTGAACCGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Biosciences
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GCaMP-AMPK-SPARK was a gift from Roland Malli (Addgene plasmid # 226257 ; http://n2t.net/addgene:226257 ; RRID:Addgene_226257) -
For your References section:
Development of a Dual Reporter System to Simultaneously Visualize Ca(2+) Signals and AMPK Activity. Erdogan YC, Pilic J, Gottschalk B, Yigit EN, Zaki AG, Ozturk G, Eroglu E, Okutan B, Sommer NG, Weinberg AM, Schindl R, Graier WF, Malli R. ACS Sens. 2024 Aug 21. doi: 10.1021/acssensors.4c01058. 10.1021/acssensors.4c01058 PubMed 39167044