Skip to main content

GCaMP-AMPK-SPARK
(Plasmid #226257)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 226257 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pTwist CMV
  • Backbone size w/o insert (bp) 4181
  • Total vector size (bp) 6569
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP-AMPK-SPARK
  • Alt name
    GCaMP6f-AMPK-SPARK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2388

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GAGCTGGTTTAGTGAACCGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Twist Biosciences

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GCaMP-AMPK-SPARK was a gift from Roland Malli (Addgene plasmid # 226257 ; http://n2t.net/addgene:226257 ; RRID:Addgene_226257)
  • For your References section:

    Development of a Dual Reporter System to Simultaneously Visualize Ca(2+) Signals and AMPK Activity. Erdogan YC, Pilic J, Gottschalk B, Yigit EN, Zaki AG, Ozturk G, Eroglu E, Okutan B, Sommer NG, Weinberg AM, Schindl R, Graier WF, Malli R. ACS Sens. 2024 Aug 21. doi: 10.1021/acssensors.4c01058. 10.1021/acssensors.4c01058 PubMed 39167044