pET-22b(+) pCopA RBS30 mscarlet
(Plasmid
#226370)
-
PurposePlasmid carries copper sensor circuit genes for whole-cell sensing of copper ions with RBS30
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226370 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-22b(+)
- Backbone size w/o insert (bp) 5518
- Total vector size (bp) 6517
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet
-
SpeciesSynthetic
-
Insert Size (bp)999
- Promoter copA promoter (pCopA)
-
Tag
/ Fusion Protein
- 6x Histag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAGCAGCCAACTCAGCTTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-22b(+) pCopA RBS30 mscarlet was a gift from Urartu Seker (Addgene plasmid # 226370 ; http://n2t.net/addgene:226370 ; RRID:Addgene_226370) -
For your References section:
Genetically engineered bacterial biofilm materials enhances portable whole cell sensing. Koksaldi IC, Avci E, Kose S, Ozkul G, Kehribar ES, Safak Seker UO. Biosens Bioelectron. 2024 Aug 10;264:116644. doi: 10.1016/j.bios.2024.116644. 10.1016/j.bios.2024.116644 PubMed 39137519