pZa pBAD csgA CBDcex pLac Ara csgGEF
(Plasmid
#226378)
-
PurposePlasmid carries csgA and csgG,E,F genes of curli operon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226378 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepZa
- Backbone size w/o insert (bp) 6211
- Total vector size (bp) 9158
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecsgA and csgG,E,F genes of curli operon
-
SpeciesCellulomonas fimi
-
Insert Size (bp)2947
- Promoter pBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgacgctttttatcgcaactctctactg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZa pBAD csgA CBDcex pLac Ara csgGEF was a gift from Urartu Seker (Addgene plasmid # 226378 ; http://n2t.net/addgene:226378 ; RRID:Addgene_226378) -
For your References section:
Genetically engineered bacterial biofilm materials enhances portable whole cell sensing. Koksaldi IC, Avci E, Kose S, Ozkul G, Kehribar ES, Safak Seker UO. Biosens Bioelectron. 2024 Aug 10;264:116644. doi: 10.1016/j.bios.2024.116644. 10.1016/j.bios.2024.116644 PubMed 39137519