PB_p300_core-dCas9-EGFP_hygro
(Plasmid
#226431)
-
PurposePiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePiggyBac dCas9-VPR
- Backbone size w/o insert (bp) 15642
- Total vector size (bp) 16392
-
Modifications to backboneChanged the BFP reporter gene to EGFP and swapped the puromycin resistance for hygromycin resistance. Removed the BspQI restriction enzyme site. Swapped the VPR for the p300 core sequence.
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology ; PiggyBac Transposon
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namep300 core-dCas9-EGFP fusion protein
-
SpeciesH. sapiens (human), Synthetic; Streptococcus pyogenes
-
Insert Size (bp)6912
- Promoter Dox inducible minimal CMV
-
Tags
/ Fusion Proteins
- p300 core (N terminal on insert)
- HA tag (C terminal on insert)
- P2A-EGFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer attttcaaaccagaagaactacgacag (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namertTA3-IRES-Hygro
-
SpeciesSynthetic
-
Insert Size (bp)2365
- Promoter UbC Promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cgataataccatgAAAAAGCCTGAACTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe p300 core sequence was PCR amplified from pcDNA-dCas9-p300 core (Addgene #61357), and the EGFP was PCR amplified from pGL3-U6-sgRNA-EGFP (Addgene #107721).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB_p300_core-dCas9-EGFP_hygro was a gift from Alon Goren (Addgene plasmid # 226431 ; http://n2t.net/addgene:226431 ; RRID:Addgene_226431)