PB_p300_core-dCas9-EGFP_hygro
(Plasmid #226431)

• Purpose: PiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection marker
• Depositing Lab: Alon Goren
• Depositing Organization: University of California, San Diego (UCSD)
  Located in the United States of America
• Publication: PiggyBac CRISPR-dCas9 fusion protein and gRNA donor plasmids (unpublished)

Backbone

• Vector backbone: PiggyBac dCas9-VPR
• Backbone size w/o insert (bp): 15642
• Total vector size (bp): 16392
• Modifications to backbone: Changed the BFP reporter gene to EGFP and swapped the puromycin resistance for hygromycin resistance. Removed the BspQI restriction enzyme site. Swapped the VPR for the p300 core sequence.
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac Transposon
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: p300 core-dCas9-EGFP fusion protein
• Species: H. sapiens (human), Synthetic; Streptococcus pyogenes
• Insert Size (bp): 6912
• Promoter: Dox inducible minimal CMV
• Tags / Fusion Proteins:
  • p300 core (N terminal on insert)
  • HA tag (C terminal on insert)
  • P2A-EGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: attttcaaaccagaagaactacgacag

Gene/Insert 2

• Gene/Insert name: rtTA3-IRES-Hygro
• Species: Synthetic
• Insert Size (bp): 2365
• Promoter: UbC Promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgataataccatgAAAAAGCCTGAACTCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The p300 core sequence was PCR amplified from pcDNA-dCas9-p300 core (Addgene #61357), and the EGFP was PCR amplified from pGL3-U6-sgRNA-EGFP (Addgene #107721).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 226431-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 226431-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.