Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCDHblast MCSNard OST-LMNA
(Plasmid #22661)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22661 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDHblast
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lamin A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Entrez Gene
    LMNA (a.k.a. CDCD1, CDDC, CMD1A, CMT2B1, EMD2, FPL, FPLD, FPLD2, HGPS, IDC, LDP1, LFP, LGMD1B, LMN1, LMNC, LMNL1, MADA, PRO1)
  • Tag / Fusion Protein
    • Onestrep Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI, XhoI, NotI, SwaI, BglII, AsuII (not destroyed)
  • 5′ sequencing primer AAATGGGCGGTAGGCGTGT
  • 3′ sequencing primer TCTCTAGGCACCCGTTCAAT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDHblast MCSNard OST-LMNA was a gift from Tom Misteli (Addgene plasmid # 22661 ; http://n2t.net/addgene:22661 ; RRID:Addgene_22661)
  • For your References section:

    Ageing-related chromatin defects through loss of the NURD complex. Pegoraro G, Kubben N, Wickert U, Göhler H, Hoffmann K, Misteli T. Nat Cell Biol. 2009 Oct . 11(10):1261-7. 10.1038/ncb1971 PubMed 19734887