Skip to main content

pMH-HA/Joseph2-Multitagged Plasmid
(Plasmid #226726)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 226726 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMH-HA
  • Backbone manufacturer
    Addgene
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pMH-HA/Joseph2
  • Promoter CMV
  • Tag / Fusion Protein
    • HA, Myc, GFP, Flag, V5, His

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH-HA/Joseph2-Multitagged Plasmid was a gift from Richard Cripps (Addgene plasmid # 226726 ; http://n2t.net/addgene:226726 ; RRID:Addgene_226726)
  • For your References section:

    pJoseph2: a family of plasmids as positive controls for bacterial protein expression, transfections, and western blots. Robinson E, Alonso EB, A Waters J, Bileckyj C, D House C, A Johnston C, M Cripps R. Biotechniques. 2024;76(7):299-309. doi: 10.1080/07366205.2024.2343609. Epub 2024 May 12. 10.1080/07366205.2024.2343609 PubMed 39185782