p140Tol2-Olactb:SABER
(Plasmid
#226829)
-
PurposeExpression of beta actin driven BFP and molecular barcode array for SABER-seq in zebrafish. Also contains heat-shock activated mCherry reporter and CreERT2.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTol2
- Total vector size (bp) 16048
-
Vector typezebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameBFP-SABER
-
Insert Size (bp)1353
- Promoter Olactb
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAAGCGCGATCACATGGTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry-t2A-CreERT2
-
Insert Size (bp)3016
- Promoter hsp70
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCCCGACGAGGTGTTTATTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p140Tol2-Olactb:SABER was a gift from Bushra Raj (Addgene plasmid # 226829 ; http://n2t.net/addgene:226829 ; RRID:Addgene_226829) -
For your References section:
Barcoding Notch signaling in the developing brain. Siniscalco AM, Perera RP, Greenslade JE, Veeravenkatasubramanian H, Masters A, Doll HM, Raj B. Development. 2024 Nov 22:dev.203102. doi: 10.1242/dev.203102. 10.1242/dev.203102 PubMed 39575683