p128Tol2-Olactb:Cas9-t2A-GFP, 4xU6:sgRNA
(Plasmid
#226834)
-
PurposeExpression of b-actin driven Cas9-GFP and U6-driven 4 sgRNAs in zebrafish
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTol2
- Total vector size (bp) 15640
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9-t2A-GFP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)5276
- Promoter Olactb
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer AACGAAATGGCTAAGGTGGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name4xU6:sgRNA
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)2115
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ACATTAAATGAAATGCATcagt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p128Tol2-Olactb:Cas9-t2A-GFP, 4xU6:sgRNA was a gift from Bushra Raj (Addgene plasmid # 226834 ; http://n2t.net/addgene:226834 ; RRID:Addgene_226834) -
For your References section:
Barcoding Notch signaling in the developing brain. Siniscalco AM, Perera RP, Greenslade JE, Veeravenkatasubramanian H, Masters A, Doll HM, Raj B. Development. 2024 Nov 22:dev.203102. doi: 10.1242/dev.203102. 10.1242/dev.203102 PubMed 39575683