EF1α-TetOn3G_2x cHS4_pTRE3G-loxP-EGFP-lox2272 [AAVS1]
(Plasmid
#227246)
-
PurposeAll-in-one ROSE LP donor construct for TetOn3G-inducible cell line development in HEK293 cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 7930
-
Vector typeMammalian Expression, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTet-On 3G transactivator protein
-
Alt nameTetOn3G
-
SpeciesSynthetic
-
Insert Size (bp)747
- Promoter EF1α
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer GAGTGGGTGGAGACTGAAGTTA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEnhanced green fluorescent protein
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter pTRE3G
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer GAATTCCTCGAGTTTACTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1α-TetOn3G_2x cHS4_pTRE3G-loxP-EGFP-lox2272 [AAVS1] was a gift from Jae Seong Lee (Addgene plasmid # 227246 ; http://n2t.net/addgene:227246 ; RRID:Addgene_227246) -
For your References section:
A precise and sustainable doxycycline-inducible cell line development platform for reliable mammalian cell engineering with gain-of-function mutations. Shin SW, Min H, Kim J, Lee JS. Metab Eng. 2024 Sep 5;86:12-28. doi: 10.1016/j.ymben.2024.09.004. 10.1016/j.ymben.2024.09.004 PubMed 39242074