Skip to main content

pDsRed-miR9 Sensor
(Plasmid #22742)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22742 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV-DsRed-Express (modified with added BglII and EcoRI sites
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4600
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5 alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    microRNA 9 binding sites
  • Alt name
    mir9
  • Insert Size (bp)
    53

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer Unknown
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    DNA cloned within Hudson lab
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

2 miR9 binding sites (TCATACAGCTAGATAACCAAAGA) inserted between BglII and EcoRI site of pDsRed-Sensor. AscI site separates the two binding sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDsRed-miR9 Sensor was a gift from Lynn Hudson (Addgene plasmid # 22742 ; http://n2t.net/addgene:22742 ; RRID:Addgene_22742)
  • For your References section:

    Identification of dynamically regulated microRNA and mRNA networks in developing oligodendrocytes. Lau P, Verrier JD, Nielsen JA, Johnson KR, Notterpek L, Hudson LD. J Neurosci. 2008 Nov 5. 28(45):11720-30. 10.1523/JNEUROSCI.1932-08.2008 PubMed 18987208