Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDsRed-miR9 Sensor
(Plasmid #22742)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22742 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-DsRed-Express (modified with added BglII and EcoRI sites
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4600
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5 alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    microRNA 9 binding sites
  • Alt name
    mir9
  • Insert Size (bp)
    53

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer Unknown
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

2 miR9 binding sites (TCATACAGCTAGATAACCAAAGA) inserted between BglII and EcoRI site of pDsRed-Sensor. AscI site separates the two binding sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDsRed-miR9 Sensor was a gift from Lynn Hudson (Addgene plasmid # 22742 ; http://n2t.net/addgene:22742 ; RRID:Addgene_22742)
  • For your References section:

    Identification of dynamically regulated microRNA and mRNA networks in developing oligodendrocytes. Lau P, Verrier JD, Nielsen JA, Johnson KR, Notterpek L, Hudson LD. J Neurosci. 2008 Nov 5. 28(45):11720-30. 10.1523/JNEUROSCI.1932-08.2008 PubMed 18987208