pHThMeCP2 (pc3972)
(Plasmid
#227639)
-
PurposeMammalian expression vector for human MeCP2 C-terminally tagged to HaloTag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClonetech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMeCP2
-
SpeciesH. sapiens (human)
-
Entrez GeneMECP2 (a.k.a. AUTSX3, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT)
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHThMeCP2 (pc3972) was a gift from Cristina Cardoso (Addgene plasmid # 227639 ; http://n2t.net/addgene:227639 ; RRID:Addgene_227639) -
For your References section:
The Proteomic Composition and Organization of Constitutive Heterochromatin in Mouse Tissues. Schmidt A, Zhang H, Schmitt S, Rausch C, Popp O, Chen J, Cmarko D, Butter F, Dittmar G, Lermyte F, Cardoso MC. Cells. 2024 Jan 11;13(2):139. doi: 10.3390/cells13020139. 10.3390/cells13020139 PubMed 38247831