Skip to main content

pBTL-1
(Plasmid #22805)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22805 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBTL-1
  • Backbone size (bp) 2662
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRV (unknown if destroyed)
  • 5′ sequencing primer AGCGGATAACAATTTCACACTCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's QC sequence shows a 1bp insertion with the author's provided sequence. The lab does not believe this affects the plasmid activity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBTL-1 was a gift from Ryan Gill (Addgene plasmid # 22805 ; http://n2t.net/addgene:22805 ; RRID:Addgene_22805)
  • For your References section:

    Broad host range vectors for stable genomic library construction. Lynch MD, Gill RT. Biotechnol Bioeng. 2006 May 5. 94(1):151-8. 10.1002/bit.20836 PubMed 16496398