pTYB3-T4gp43(WT)
(Plasmid
#228203)
-
PurposeExpression in BL21(DE3) of WT T4 DNA polymerase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYB3
-
Backbone manufacturerNew England BioLabs
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name43
-
SpeciesEscherichia phage T4
- Promoter T7
-
Tag
/ Fusion Protein
- Sce VMA intein-chitin binding domain (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains a 183bp deletion of one of the rrnB T1 terminator repeats. This deletion is not known to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYB3-T4gp43(WT) was a gift from Stephen Benkovic (Addgene plasmid # 228203 ; http://n2t.net/addgene:228203 ; RRID:Addgene_228203)