pAAV-Ucp1-Cre-miR122
(Plasmid
#228408)
-
PurposeExpression of Cre recombinase from a rat Ucp1 enhancer-promoter. Contains miR122 target sequences that suppress expression in hepatocytes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-ucp1-Cre-3xmiR122-WPRE-HGHpA
- Backbone size w/o insert (bp) 5184
- Total vector size (bp) 5916
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namecre recombinase with SV40 NLS
-
SpeciesSynthetic
-
GenBank ID
- Promoter rat Ucp1 enhancer-promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer gtggctgccacagaagttcg
- 3′ sequencing primer agctgacaggtggtggcaat (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCre recombinase with SV40 NLS
-
SpeciesSynthetic
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBen Deverman (pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA; Addgene plasmid # 183776).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ucp1-Cre-miR122 was a gift from Joerg Heeren (Addgene plasmid # 228408 ; http://n2t.net/addgene:228408 ; RRID:Addgene_228408) -
For your References section:
An efficient AAV vector system of Rec2 serotype for intravenous injection to study metabolism in brown adipocytes in vivo. Behrens J, Braren I, Jaeckstein MY, Lilie L, Heine M, Sass F, Sommer J, Silbert-Wagner D, Fuh MM, Worthmann A, Straub L, Moustafa T, Heeren J, Scheja L. Mol Metab. 2024 Oct;88:101999. doi: 10.1016/j.molmet.2024.101999. Epub 2024 Jul 31. 10.1016/j.molmet.2024.101999 PubMed 39094948