Skip to main content

pAAV-Ucp1-Cre-miR122
(Plasmid #228408)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228408 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-ucp1-Cre-3xmiR122-WPRE-HGHpA
  • Backbone size w/o insert (bp) 5184
  • Total vector size (bp) 5916
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    cre recombinase with SV40 NLS
  • Species
    Synthetic
  • GenBank ID
  • Promoter rat Ucp1 enhancer-promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer gtggctgccacagaagttcg
  • 3′ sequencing primer agctgacaggtggtggcaat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cre recombinase with SV40 NLS
  • Species
    Synthetic

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ben Deverman (pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA; Addgene plasmid # 183776).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ucp1-Cre-miR122 was a gift from Joerg Heeren (Addgene plasmid # 228408 ; http://n2t.net/addgene:228408 ; RRID:Addgene_228408)
  • For your References section:

    An efficient AAV vector system of Rec2 serotype for intravenous injection to study metabolism in brown adipocytes in vivo. Behrens J, Braren I, Jaeckstein MY, Lilie L, Heine M, Sass F, Sommer J, Silbert-Wagner D, Fuh MM, Worthmann A, Straub L, Moustafa T, Heeren J, Scheja L. Mol Metab. 2024 Oct;88:101999. doi: 10.1016/j.molmet.2024.101999. Epub 2024 Jul 31. 10.1016/j.molmet.2024.101999 PubMed 39094948