pcDNA3.1-FRET_PST-N
(Plasmid
#228571)
-
PurposeExpressed a FRET sensor for determining proteolytic cleavage of the N-terminal side of Pancreastatin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChromogranin-A
-
Alt nameCgA
-
Alt namePituitary secretory protein I (SP-I)
-
SpeciesH. sapiens (human)
-
MutationFRET sensor; see explanatory note
-
GenBank IDNM_001275.3
-
Entrez GeneCHGA (a.k.a. CGA, PHE5, PHES)
- Promoter cmv
-
Tags
/ Fusion Proteins
- mCitrine
- mScarlet-I (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
FRET sensor consisting of:
1-residue hCGA(1-115),
2-mCitrine,
3-EcoRI,
4-N-terminal cleavage site of PST,
5-BamHI,
6-mScarlet-I,
7-XbaI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-FRET_PST-N was a gift from Geert van den Bogaart (Addgene plasmid # 228571 ; http://n2t.net/addgene:228571 ; RRID:Addgene_228571) -
For your References section:
Inflammation Promotes Proteolytic Processing of the Prohormone Chromogranin A by Macrophages. Ioannidis M, van Dijk H, Muntjewerff EM, Chirasani VR, Warner H, van den Dool W, Grijpstra P, Bianchi F, Mahata SK, van den Bogaart G. J Endocr Soc. 2025 May 15;9(7):bvaf090. doi: 10.1210/jendso/bvaf090. eCollection 2025 Jul. 10.1210/jendso/bvaf090 PubMed 40458085