FIREC-PBCS-MR3
(Plasmid
#228700)
-
PurposeControl cassette FIRE2, FIRE fluorescent ratiometric sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonenonspecific
-
Vector typeMammalian Expression, Synthetic Biology, Unspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFIRE2 CONTROL
-
SpeciesSynthetic
- Promoter EF1-alpha
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer ACATGCGTCAATTTTACGCATGATTATCTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FIREC-PBCS-MR3 was a gift from Carolyn Sangokoya (Addgene plasmid # 228700 ; http://n2t.net/addgene:228700 ; RRID:Addgene_228700) -
For your References section:
The FIRE biosensor illuminates iron regulatory protein activity and cellular iron homeostasis. Sangokoya C. Cell Rep Methods. 2025 Jan 11:100960. doi: 10.1016/j.crmeth.2024.100960. 10.1016/j.crmeth.2024.100960 PubMed 39824193