Skip to main content

pLV_3XHA-ATP6V1B2-mNeonGreen
(Plasmid #228865)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228865 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-Ef1a-IRES Blast
  • Backbone manufacturer
    Addgene #85133
  • Backbone size w/o insert (bp) 8567
  • Total vector size (bp) 10871
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP6V1B2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2346
  • Entrez Gene
    ATP6V1B2 (a.k.a. ATP6B1B2, ATP6B2, DOOD, HO57, VATB, VPP3, Vma2, ZLS2)
  • Tags / Fusion Proteins
    • 3xHA (N terminal on insert)
    • mNeonGreen (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGAGTGGGTGGAGACTGAAG
  • 3′ sequencing primer CTTCGGCCAGTAACGTTAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_3XHA-ATP6V1B2-mNeonGreen was a gift from Wilhelm Palm (Addgene plasmid # 228865 ; http://n2t.net/addgene:228865 ; RRID:Addgene_228865)
  • For your References section:

    Direct control of lysosomal catabolic activity by mTORC1 through regulation of V-ATPase assembly. Ratto E, Chowdhury SR, Siefert NS, Schneider M, Wittmann M, Helm D, Palm W. Nat Commun. 2022 Aug 17;13(1):4848. doi: 10.1038/s41467-022-32515-6. 10.1038/s41467-022-32515-6 PubMed 35977928